Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10203

HP ID(1) HP10203
Gene ID(2) 9141
Gene Symbol finder PDCD5
Protein Name programmed cell death 5
RefSeq NM_004708.2
Length of RefSeq (bp) 599
Chromosome 19q12-q13.1
Reference DDBJ accession
UniGene Hs.443831

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe98H05 pKA1U5 GGGTCAAGGCCGCGCTCGCGCCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTG
ARiS055L12 pGCAP10 GGCGCTCGCGCCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCC
RBb02D04 pKA1U5 ATCCTGGGCGAGGGGCTGCGAGAGTGACCGCGNCCTNTTCCAGCGCTGACGCCGAGCCAT
RBb39F12 pGCAP1 GGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGGACGA
RBd05D12 pGCAP10 GAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCG
RBd08G10 pGCAP10 GAGTGGTCAAGGCCGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCG
RBd26D11 pGCAP10 GAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCGCTGAGGAGACAGAGGCTG
RBd30A12 pGCAP10 GGCGCAGTGGTCAAGGCCGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCC
RBd39D07 pGCAP10 GGCAGTGGTCAAGGCCGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAG
RBd39H05 pGCAP10 GGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCC
RBd60G06 pGCAP10 GGGATTCNNCTTGAGCTGGCGGCGAGNGGCCTGGAGAACGCTGAGCACTCCCCCAGGGGC
RBd60H06 pGCAP10 GGGTCAAGGCCGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTG
RBd72G05 pGCAP10 GGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCGCTGAGGAGACAGAGGCTGGCC
RBdS040D19 pGCAP10 GGCTCCAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCGCTGAGGAGACAGA
RBdS083O01 pGCAP10 GGGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGG
RBdS132A12 pGCAP10 GAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl