Prev. |  KEGG KO K06875 > 

RIKEN DNA Bank Human Resource - PDCD5

Gene ID NCBI Gene 9141 |  KEGG hsa:9141
Gene Symbol PDCD5
Protein Name programmed cell death 5
Synonyms TFAR19
Ortholog resources KEGG ortholog (KEGG orthology K06875) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008901 IRAK022E05 pCMV-SPORT6 BC015519 NM_004708 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE020994 W01A052I02 pENTR-TOPO IRAK022E05 BC015519 NM_004708  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR079373 ARe98H05 pKA1U5 NM_004708.2  
GGGTCAAGGCCGCGCTCGCGCCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTG
HKR222276 ARiS055L12 pGCAP10 NM_004708.2  
GGCGCTCGCGCCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCC
HKR320876 RBb02D04 pKA1U5 NM_004708.2  
ATCCTGGGCGAGGGGCTGCGAGAGTGACCGCGNCCTNTTCCAGCGCTGACGCCGAGCCAT
HKR335732 RBb39F12 pGCAP1 NM_004708.2  
GGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGGACGA
HKR362084 RBd05D12 pGCAP10 NM_004708.2  
GAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCG
HKR363354 RBd08G10 pGCAP10 NM_004708.2  
GAGTGGTCAAGGCCGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCG
HKR370483 RBd26D11 pGCAP10 NM_004708.2  
GAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCGCTGAGGAGACAGAGGCTG
HKR372012 RBd30A12 pGCAP10 NM_004708.2  
GGCGCAGTGGTCAAGGCCGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCC
HKR375679 RBd39D07 pGCAP10 NM_004708.2  
GGCAGTGGTCAAGGCCGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAG
HKR375773 RBd39H05 pGCAP10 NM_004708.2  
GGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCC
HKR384150 RBd60G06 pGCAP10 NM_004708.2  
GGGATTCNNCTTGAGCTGGCGGCGAGNGGCCTGGAGAACGCTGAGCACTCCCCCAGGGGC
HKR384174 RBd60H06 pGCAP10 NM_004708.2  
GGGTCAAGGCCGCGCTCGCGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTG
HKR388949 RBd72G05 pGCAP10 NM_004708.2  
GGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCGCTGAGGAGACAGAGGCTGGCC
HKR416091 RBdS040D19 pGCAP10 NM_004708.2  
GGCTCCAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCGCTGAGGAGACAGA
HKR433537 RBdS083O01 pGCAP10 NM_004708.2  
GGGGCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGG
HKR452812 RBdS132A12 pGCAP10 NM_004708.2  
GAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl