Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10195

HP ID(1) HP10195
Gene ID(2) 9218
Gene Symbol finder VAPA
Protein Name VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
RefSeq NM_003574.5
Length of RefSeq (bp) 6994
Chromosome 18p11.22
Reference DDBJ accession
UniGene Hs.699980

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS020L20 pGCAP10 GGCCGTGGCGGCTGGTGTGGGGTTGAGTCAGTTGTGGGACCCGGAGCTGCTGACCCAGCG
ARiS161H01 pGCAP10 GAAGTGCGCGTGGCCGTGGCGGCTGGTGTGNGTTGAGTCAGTTGTGGNACCCGNANCTGN
RBd63G08 pGCAP10 GGCCGCGGGCGCGCCCCCGCTCTGCGCTGTCTCTCCGATGGCGTCCGCCTCAGGGGCCAT
RBd99B07 pGCAP10 GGCCGCGGGCGCGCCCCCGCTCTGCGCTGTCTCTCCGATGGCGTCCGCCTCAGGGGCCAT
RBdS104F01 pGCAP10 TGGGGGTCGCCGAGGCTCGCAAGTGCGCGTGGCCGTGGCGGCTGGTGTGGGGTTGAGTCA
RBdS177J03 pGCAP10 GGCGCCCCCGCTCTGCGCTGTCTCTCCGATGGCGTCCGCCTCAGGGGCCATGGCGAAGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl