Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10193

HP ID(1) HP10193
Gene ID(2) 55003
Gene Symbol finder PAK1IP1
Protein Name PAK1 interacting protein 1
RefSeq NM_017906.2
Length of RefSeq (bp) 1511
Chromosome 6p24.2
Reference DDBJ accession
UniGene Hs.310231

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi23A11 pGCAP10 GGTCACCTCCAGGCTGAGCCGGGCTGGCGGAAGAGGCACGTGCGCTGCTGAATGGAGCTG
RBb21E09 pKA1U5 GGCCGGGCTGGCGGAAGAGGCACGTGCGCTGCTGAATGGAGCTGGTCGCTGGTTGCTACG
RBd98C07 pGCAP10 GAGGCACGTGCGCTGCTGAATGGAGCTGGTCGCTGGTTGCTACGAGCAGGTCCTCTTTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl