Prev. |  KEGG KO K14830 > 

RIKEN DNA Bank Human Resource - PAK1IP1

Gene ID NCBI Gene 55003 |  KEGG hsa:55003
Gene Symbol PAK1IP1
Protein Name PAK1 interacting protein 1
Synonyms MAK11|PIP1|WDR84|bA421M1.5|hPIP1
Ortholog resources KEGG ortholog (KEGG orthology K14830) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087803 IRAL019I11 pDNR-LIB BC010907 NM_017906 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169211 ARi23A11 pGCAP10 NM_017906.2  
GGTCACCTCCAGGCTGAGCCGGGCTGGCGGAAGAGGCACGTGCGCTGCTGAATGGAGCTG
HKR328505 RBb21E09 pKA1U5 NM_017906.2  
GGCCGGGCTGGCGGAAGAGGCACGTGCGCTGCTGAATGGAGCTGGTCGCTGGTTGCTACG
HKR399255 RBd98C07 pGCAP10 NM_017906.2  
GAGGCACGTGCGCTGCTGAATGGAGCTGGTCGCTGGTTGCTACGAGCAGGTCCTCTTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl