Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10181

HP ID(1) HP10181
Gene ID(2) 5719
Gene Symbol finder PSMD13
Protein Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
RefSeq NM_002817.3
Length of RefSeq (bp) 1757
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.134688

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi36F05 pGCAP10 GAGCATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGCCGGGG
ARi51F03 pGCAP10 ATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGCCGGGGGTCT
ARi58F06 pGCAP10 GGAGTGAGCATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGC
ARiS013H03 pGCAP10 GGTTGTTCTTCTGTGCCGGGGGTCTTCCTGCTGTCATGAAGGACGTACCGGGCTTCCTAC
RBb09H04 pKA1U5 GCCGGCAGCCATCCCCGCGGTGCTGACATCCCCGCTTGTTCTTCTGTGCCGGGGGTCTTC
RBdS156K05 pGCAP10 GGAGCATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGCCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl