Prev. |  KEGG KO K03039 > 

RIKEN DNA Bank Human Resource - PSMD13

Gene ID NCBI Gene 5719 |  KEGG hsa:5719
Gene Symbol PSMD13
Protein Name proteasome 26S subunit, non-ATPase 13
Synonyms HSPC027|Rpn9|S11|p40.5
Ortholog resources KEGG ortholog (KEGG orthology K03039) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083133 IRAL007N21 pOTB7 BC001100 NM_002817 Full
HGY083419 IRAL008J03 pOTB7 BC001747 NM_002817 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006266 W01A015L02 pENTR-TOPO IRAL008J03 BC001747 NM_002817  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174525 ARi36F05 pGCAP10 NM_002817.3  
GAGCATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGCCGGGG
HKR180523 ARi51F03 pGCAP10 NM_002817.3  
ATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGCCGGGGGTCT
HKR183326 ARi58F06 pGCAP10 NM_002817.3  
GGAGTGAGCATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGC
HKR205371 ARiS013H03 pGCAP10 NM_002817.3  
GGTTGTTCTTCTGTGCCGGGGGTCTTCCTGCTGTCATGAAGGACGTACCGGGCTTCCTAC
HKR323772 RBb09H04 pKA1U5 NM_002817.3  
GCCGGCAGCCATCCCCGCGGTGCTGACATCCCCGCTTGTTCTTCTGTGCCGGGGGTCTTC
HKR462645 RBdS156K05 pGCAP10 NM_002817.3  
GGAGCATTTCCGGCAGCCATCCCCGCGGTGCTGACATCCCGGTTGTTCTTCTGTGCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl