Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10177

HP ID(1) HP10177
Gene ID(2) 11164
Gene Symbol finder NUDT5
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 5
RefSeq NM_014142.2
Length of RefSeq (bp) 1224
Chromosome 10p14-p13
Reference DDBJ accession
UniGene Hs.555956

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe45C06 pKA1U5 GGTTTCGAGCCGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTCGTC
ARi41C10 pGCAP10 GGGTGTTTCGAGCCGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTC
RBd10H09 pGCAP10 GGCCCATCCTTTTAGCACCGCGAGAGGCGCCGGTGTTTCGAGCCGTGGCACCGGCATCGG
RBd89F01 pGCAP10 GGTTCTACGGATGCCGGAAGGAGGGTGCGCGCCCATCCTTTTAGCACCGCGAGAGGCGCC
RBdS022D21 pGCAP10 GGTTTCGAGCCGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTCGTC
RBdS104M20 pGCAP10 GGTTTTTCGAGCCGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTCG
RBdS110E24 pGCAP10 GGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTCGTCCTCTTCCGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl