Prev. |  KEGG KO K13987 > 

RIKEN DNA Bank Human Resource - NUDT5

Gene ID NCBI Gene 11164 |  KEGG hsa:11164
Gene Symbol NUDT5
Protein Name nudix hydrolase 5
Synonyms YSA1|YSA1H|YSAH1|hNUDT5
Ortholog resource in our bank

  NUDT5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083075 IRAL007L11 pOTB7 BC000025 NM_014142 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058054 ARe45C06 pKA1U5 NM_014142.2  
GGTTTCGAGCCGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTCGTC
HKR176458 ARi41C10 pGCAP10 NM_014142.2  
GGGTGTTTCGAGCCGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTC
HKR364177 RBd10H09 pGCAP10 NM_014142.2  
GGCCCATCCTTTTAGCACCGCGAGAGGCGCCGGTGTTTCGAGCCGTGGCACCGGCATCGG
HKR395721 RBd89F01 pGCAP10 NM_014142.2  
GGTTCTACGGATGCCGGAAGGAGGGTGCGCGCCCATCCTTTTAGCACCGCGAGAGGCGCC
HKR408893 RBdS022D21 pGCAP10 NM_014142.2  
GGTTTCGAGCCGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTCGTC
HKR441908 RBdS104M20 pGCAP10 NM_014142.2  
GGTTTTTCGAGCCGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTCG
HKR444120 RBdS110E24 pGCAP10 NM_014142.2  
GGTGGCACCGGCATCGGCTGACACTGCTGCCTCCAGCTAGTTATTTCGTCCTCTTCCGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl