Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10175

HP ID(1) HP10175
Gene ID(2) 51522
Gene Symbol finder TMEM14C
Protein Name transmembrane protein 14C
RefSeq NM_016462.2
Length of RefSeq (bp) 1011
Chromosome 6p24.2
Reference DDBJ accession
UniGene Hs.519557

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe51F03 pKA1U5 GGCTGAATGCAGGGCGCATGCTGCTACTTGGCGGCTCAAGCCCCGCCCGCACCGTCCCCA
ARf02H10 pKA1U5 GACTGCGCAGGCACAACAGAGCCGCTCCCCTCTCCTCGCCCCGCCACCGGGACGGAGAGC
ARi20B09 pGCAP10 GGACACCTCGCAGTCATTCCTGCGGCTTGCGCGCCCTTGTAGACAGCCGGGGCCTTCGTG
ARi34D01 pGCAP10 GAGGCACAACAGAGCCGCTCCCCTCTCCTCGCCCCGCCACCGGGACGGAGAGCGCCCGCC
ARi54H02 pGCAP10 TCCGGGACGGAGAGCGCCCGCCGCTGCATTTCCGGCGACACCTCGCAGTCATTCCTGCGG
ARi55B02 pGCAP10 GGCCACCGGGACGGACAGCGCCCACCGCTGCATTTCCGGCGACCCCTCGCAGTCATTCCT
ARiS109I22 pGCAP10 GACCTCGCAGTCATTCCTGCGGCTTGCGCGCCCTTGTAGACAGCCGGGGCCTTCGTGAGA
ARiS161L03 pGCAP10 GCTCTCCTCGCCCCGCCACCGGGACGGAGAGCGCCCGCCGCTGCATTTCCGGCGACACCT
RBb06B03 pKA1U5 GCTCTCCTCGCCCCGCCACCGGGACGGAGAGCGCCCGCCGCTGCATTTCCGGCGACACCT
RBb31C01 pGCAP1 GACACTGGCGCAGGCACAACAGAGCCGCTCCCCTCTCCTCGCCCCGCCACCGGGACGGAG
RBd28A12 pGCAP10 GATTCTCTGACCGCCCCTCTCCCGGTACACTGCGCAGGCACAACAGAGCCGCTCCCCTCT
RBd59B08 pGCAP10 GATTCTCTGACCGCCCCTCTCCCGGTACACTGCGCAGGCACAACAGAGCCGCTCCCCTCT
RBd84F11 pGCAP10 GNNTCGGNNAANNCCCCTCTCGGANCTNNNNTNNNNNNGGNNTANTTNNNNCTCCNNNCN
RBd96H03 pGCAP10 GGTCCCCATTCTCTGACCGCCCCTCTCCCGGTACACTGCGCAGGCACAACAGAGCCGCTC
RBdS083L08 pGCAP10 GCCTCTCCTCGCCCCGCCACCGGGACGGAGAGCGCCCGCCGCTGCATTTCCGGCGACACC
RBdS132J14 pGCAP10 GACTGCGCAGGCACAACAGAGCCGCTCCCCTCTCCTCGCCCCGCCACCGGGACGGAGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl