Prev. | 

RIKEN DNA Bank Human Resource - TMEM14C

Gene ID NCBI Gene 51522 |  KEGG hsa:51522
Gene Symbol TMEM14C
Protein Name transmembrane protein 14C
Synonyms C6orf53|HSPC194|MSTP073|NET26|bA421M1.6
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081701 IRAL004E05 pOTB7 BC002496 NM_016462 Full
HGY090810 IRAL027A10 pOTB7 BC010086 NM_016462 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017843 W01A044K03 pENTR-TOPO IRAL004E05 BC002496 NM_016462  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060523 ARe51F03 pKA1U5 NM_016462.2  
GGCTGAATGCAGGGCGCATGCTGCTACTTGGCGGCTCAAGCCCCGCCCGCACCGTCCCCA
HKR080978 ARf02H10 pKA1U5 NM_016462.2  
GACTGCGCAGGCACAACAGAGCCGCTCCCCTCTCCTCGCCCCGCCACCGGGACGGAGAGC
HKR168033 ARi20B09 pGCAP10 NM_016462.2  
GGACACCTCGCAGTCATTCCTGCGGCTTGCGCGCCCTTGTAGACAGCCGGGGCCTTCGTG
HKR173673 ARi34D01 pGCAP10 NM_016462.2  
GAGGCACAACAGAGCCGCTCCCCTCTCCTCGCCCCGCCACCGGGACGGAGAGCGCCCGCC
HKR181770 ARi54H02 pGCAP10 NM_016462.2  
TCCGGGACGGAGAGCGCCCGCCGCTGCATTTCCGGCGACACCTCGCAGTCATTCCTGCGG
HKR182026 ARi55B02 pGCAP10 NM_016462.2  
GGCCACCGGGACGGACAGCGCCCACCGCTGCATTTCCGGCGACCCCTCGCAGTCATTCCT
HKR243814 ARiS109I22 pGCAP10 NM_016462.2  
GACCTCGCAGTCATTCCTGCGGCTTGCGCGCCCTTGTAGACAGCCGGGGCCTTCGTGAGA
HKR264667 ARiS161L03 pGCAP10 NM_016462.2  
GCTCTCCTCGCCCCGCCACCGGGACGGAGAGCGCCCGCCGCTGCATTTCCGGCGACACCT
HKR322427 RBb06B03 pKA1U5 NM_016462.2  
GCTCTCCTCGCCCCGCCACCGGGACGGAGAGCGCCCGCCGCTGCATTTCCGGCGACACCT
HKR332449 RBb31C01 pGCAP1 NM_016462.2  
GACACTGGCGCAGGCACAACAGAGCCGCTCCCCTCTCCTCGCCCCGCCACCGGGACGGAG
HKR371212 RBd28A12 pGCAP10 NM_016462.2  
GATTCTCTGACCGCCCCTCTCCCGGTACACTGCGCAGGCACAACAGAGCCGCTCCCCTCT
HKR383632 RBd59B08 pGCAP10 NM_016462.2  
GATTCTCTGACCGCCCCTCTCCCGGTACACTGCGCAGGCACAACAGAGCCGCTCCCCTCT
HKR393731 RBd84F11 pGCAP10 NM_016462.2  
GNNTCGGNNAANNCCCCTCTCGGANCTNNNNTNNNNNNGGNNTANTTNNNNCTCCNNNCN
HKR398571 RBd96H03 pGCAP10 NM_016462.2  
GGTCCCCATTCTCTGACCGCCCCTCTCCCGGTACACTGCGCAGGCACAACAGAGCCGCTC
HKR433472 RBdS083L08 pGCAP10 NM_016462.2  
GCCTCTCCTCGCCCCGCCACCGGGACGGAGAGCGCCCGCCGCTGCATTTCCGGCGACACC
HKR453030 RBdS132J14 pGCAP10 NM_016462.2  
GACTGCGCAGGCACAACAGAGCCGCTCCCCTCTCCTCGCCCCGCCACCGGGACGGAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl