Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10161

HP ID(1) HP10161
Gene ID(2) 54969
Gene Symbol finder C4orf27
Protein Name chromosome 4 open reading frame 27
RefSeq NM_017867.2
Length of RefSeq (bp) 1233
Chromosome 4q33
Reference DDBJ accession
UniGene Hs.406756

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS049G02 pGCAP10 GTGGCGCTGCAGCTGCAGAATGGTCGGCGGTGGCGGGAAGCGCAGGCCCGGCGGGGAGGG
RBd05H09 pGCAP10 GCCTTCTGGGAGATCATCGGGAATGAATTAGTTGTGAAAAAACAGTTGATGTGAAGAAAA
RBd61C03 pGCAP10 CGTGGCGCTGCAGCTGCAGAATGGTCGGCGGTGGCGGGAAGCGCAGGCCCGGCGGGGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl