Prev. | 

RIKEN DNA Bank Human Resource - HPF1

Gene ID NCBI Gene 54969 |  KEGG hsa:54969
Gene Symbol HPF1
Protein Name histone PARylation factor 1
Synonyms C4orf27
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087965 IRAL019P05 pDNR-LIB BC010367 NM_017867 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219746 ARiS049G02 pGCAP10 NM_017867.2  
GTGGCGCTGCAGCTGCAGAATGGTCGGCGGTGGCGGGAAGCGCAGGCCCGGCGGGGAGGG
HKR362177 RBd05H09 pGCAP10 NM_017867.2  
GCCTTCTGGGAGATCATCGGGAATGAATTAGTTGTGAAAAAACAGTTGATGTGAAGAAAA
HKR384451 RBd61C03 pGCAP10 NM_017867.2  
CGTGGCGCTGCAGCTGCAGAATGGTCGGCGGTGGCGGGAAGCGCAGGCCCGGCGGGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl