Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10151

HP ID(1) HP10151
Gene ID(2) 401505
Gene Symbol finder TOMM5
Protein Name translocase of outer mitochondrial membrane 5 homolog (yeast)
RefSeq NM_001001790.2
Length of RefSeq (bp) 773
Chromosome 9p13.2
Reference DDBJ accession
UniGene Hs.130774

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb49B08 pGCAP1 GGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGAGCCGCGATGTTCCGGATTGA
RBd17D05 pGCAP10 GGGGCGCGAGGCGGCCACCGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGA
RBd30G12 pGCAP10 GAAGTCAGAGCCGCGATGTTCCGGATTGAGGGCCTCGCGCCGAAGCTGGACCCGGAGGAG
RBd38G12 pGCAP10 GGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGAGCCGCGATGTTCCGGATT
RBd62A05 pGCAP10 GGGCCACCGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGAGCCGCGATGTT
RBd95A08 pGCAP10 GGGCCACCGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGAGCCGCGATGTT
RBdS075H15 pGCAP10 GAGTTCCGGGCGCGAGGCGGCCACCGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl