Prev. |  KEGG KO K17773 > 

RIKEN DNA Bank Human Resource - TOMM5

Gene ID NCBI Gene 401505 |  KEGG hsa:401505
Gene Symbol TOMM5
Protein Name translocase of outer mitochondrial membrane 5
Synonyms C9orf105|Tom5|bA613M10.3
Ortholog resource in our bank

  TOMM5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008531 IRAK021F11 pCMV-SPORT6 BC034247
HGY096463 IRAL041C15 pDNR-LIB BC029423

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092046 M01C030B22 pDONR221 MGC04-H11 BC034247 XM_933963  
HGE092094 M01C030D22 pDONR221 MGC04-H11 BC034247 XM_933963  
HGE092142 M01C030F22 pDONR221 MGC04-H11 BC034247 XM_933963  
HGE092190 M01C030H22 pDONR221 MGC04-H11 BC034247 XM_933963  
HGE092238 M01C030J22 pDONR221 MGC04-H11 BC034247 XM_933963  
HGE092286 M01C030L22 pDONR221 MGC04-H11 BC034247 XM_933963  
HGE092334 M01C030N22 pDONR221 MGC04-H11 BC034247 XM_933963  
HGE092382 M01C030P22 pDONR221 MGC04-H11 BC034247 XM_933963  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR339632 RBb49B08 pGCAP1 NM_001001790.2  
GGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGAGCCGCGATGTTCCGGATTGA
HKR366877 RBd17D05 pGCAP10 NM_001001790.2  
GGGGCGCGAGGCGGCCACCGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGA
HKR372156 RBd30G12 pGCAP10 NM_001001790.2  
GAAGTCAGAGCCGCGATGTTCCGGATTGAGGGCCTCGCGCCGAAGCTGGACCCGGAGGAG
HKR375356 RBd38G12 pGCAP10 NM_001001790.2  
GGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGAGCCGCGATGTTCCGGATT
HKR384805 RBd62A05 pGCAP10 NM_001001790.2  
GGGCCACCGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGAGCCGCGATGTT
HKR398008 RBd95A08 pGCAP10 NM_001001790.2  
GGGCCACCGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAAGTCAGAGCCGCGATGTT
HKR430183 RBdS075H15 pGCAP10 NM_001001790.2  
GAGTTCCGGGCGCGAGGCGGCCACCGTGGAGAGCAGAGCGCGGCGGCTGGAAGCTGCTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl