Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10124

HP ID(1) HP10124
Gene ID(2) 23029
Gene Symbol finder RBM34
Protein Name RNA binding motif protein 34
RefSeq NM_015014.1
Length of RefSeq (bp) 1431
Chromosome 1q42.3
Reference DDBJ accession
UniGene Hs.535224

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096H13 pGCAP10 GCTTTTTTTTTTGGAGTAAGAATGGCCTTGGAAGGGATGAGCAAACGGAAGAGAAAGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl