Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10122

HP ID(1) HP10122
Gene ID(2) 54499
Gene Symbol finder TMCO1
Protein Name transmembrane and coiled-coil domains 1
RefSeq NM_019026.3
Length of RefSeq (bp) 4456
Chromosome 1q22-q25
Reference DDBJ accession
UniGene Hs.31498

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe24B11 pKA1U5 GAAGCGGAAGTGCGATCTTCGGGCTGTCAGAGTTGGTCTGTTACTCGGTGGTGGCGGAGT
ARi39G05 pGCAP10 GTGTTGGTCTGTTACTCGGTGGTGGCGGAGTCTACGGAAGCCGTTTTCGCTTCACTTTTC
RBb13D05 pKA1U5 GAGTGCGATCTTCGGGCTGTCAGAGTTGGTCTGTTACTCGGTGGTGGCGGAGTCTACGGA
RBdS013F19 pGCAP10 GAGTTGGTCTGTTACTCGGTGGTGGCGGAGTCTACGGAAGCCGTTTTCGCTTCACTTTTC
RBdS187J10 pGCAP10 GAGAGTTGGTCTGTTACTCGGTGGTGGCGGAGTCTACGGAAGCCGTTTTCGCTTCACTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl