Prev. |  KEGG KO K21891 > 

RIKEN DNA Bank Human Resource - TMCO1

Gene ID NCBI Gene 54499 |  KEGG hsa:54499
Gene Symbol TMCO1
Protein Name transmembrane and coiled-coil domains 1
Synonyms HP10122|PCIA3|PNAS-136|TMCC4
Ortholog resource in our bank

  TMCO1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082961 IRAL007G17 pOTB7 BC000104 NM_019026 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097248 M01C043B24 pDONR221 MGC11-D12 BC000104 NM_019026  
HGE097296 M01C043D24 pDONR221 MGC11-D12 BC000104 NM_019026  
HGE097344 M01C043F24 pDONR221 MGC11-D12 BC000104 NM_019026  
HGE097392 M01C043H24 pDONR221 MGC11-D12 BC000104 NM_019026  
HGE097440 M01C043J24 pDONR221 MGC11-D12 BC000104 NM_019026  
HGE097488 M01C043L24 pDONR221 MGC11-D12 BC000104 NM_019026  
HGE097536 M01C043N24 pDONR221 MGC11-D12 BC000104 NM_019026  
HGE097584 M01C043P24 pDONR221 MGC11-D12 BC000104 NM_019026  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049635 ARe24B11 pKA1U5 NM_019026.3 done
GAAGCGGAAGTGCGATCTTCGGGCTGTCAGAGTTGGTCTGTTACTCGGTGGTGGCGGAGT
HKR175749 ARi39G05 pGCAP10 NM_019026.3  
GTGTTGGTCTGTTACTCGGTGGTGGCGGAGTCTACGGAAGCCGTTTTCGCTTCACTTTTC
HKR325277 RBb13D05 pKA1U5 NM_019026.3  
GAGTGCGATCTTCGGGCTGTCAGAGTTGGTCTGTTACTCGGTGGTGGCGGAGTCTACGGA
HKR405339 RBdS013F19 pGCAP10 NM_019026.3  
GAGTTGGTCTGTTACTCGGTGGTGGCGGAGTCTACGGAAGCCGTTTTCGCTTCACTTTTC
HKR475026 RBdS187J10 pGCAP10 NM_019026.3  
GAGAGTTGGTCTGTTACTCGGTGGTGGCGGAGTCTACGGAAGCCGTTTTCGCTTCACTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl