Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10105

HP ID(1) HP10105
Gene ID(2) 151963
Gene Symbol finder C3orf59
Protein Name chromosome 3 open reading frame 59
RefSeq NM_178496.3
Length of RefSeq (bp) 3388
Chromosome 3q29
Reference DDBJ accession
UniGene Hs.151443

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe88H03 pKA1U5 GCCCCGGAACTTCCTAGACGCCGTACGTGCCAGATGGTGTTACCTGGAGCTTAAAAAGCT
ARi48E03 pGCAP10 GAGATGGTGTTACCTGGAGCTTAAAAAGCTGCACGCAAGTGTTAAACTTCTGACAATGGC
RBd85G06 pGCAP10 GCTAGACGCCGTACGTGCCAGATGGTGTTACCTGGAGCTTAAAAAGCTGCACGCAAGTGT
RBdS075E14 pGCAP10 GAGACGCCGTACGTGCCAGATGGTGTTACCTGGAGCTTAAAAAGCTGCACGCAAGTGTTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl