Prev. | 

RIKEN DNA Bank Human Resource - MB21D2

Gene ID NCBI Gene 151963 |  KEGG hsa:151963
Gene Symbol MB21D2
Protein Name Mab-21 domain containing 2
Synonyms C3orf59
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY025332 IRAK063F12 pBluescriptR BC036194 NM_178496 Full
HGX011259 IRAK028C11 pCMV-SPORT6 BC013123 NM_178496 Full
HGY042571 IRAK106H03 pBluescript BC045582 NM_178496

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092805 M01C032A05 pDONR221 MGC05-E03 BC013123 NM_178496  
HGE092853 M01C032C05 pDONR221 MGC05-E03 BC013123 NM_178496  
HGE092901 M01C032E05 pDONR221 MGC05-E03 BC013123 NM_178496  
HGE092949 M01C032G05 pDONR221 MGC05-E03 BC013123 NM_178496  
HGE092997 M01C032I05 pDONR221 MGC05-E03 BC013123 NM_178496  
HGE093045 M01C032K05 pDONR221 MGC05-E03 BC013123 NM_178496  
HGE093093 M01C032M05 pDONR221 MGC05-E03 BC013123 NM_178496  
HGE093141 M01C032O05 pDONR221 MGC05-E03 BC013123 NM_178496  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075371 ARe88H03 pKA1U5 NM_178496.3  
GCCCCGGAACTTCCTAGACGCCGTACGTGCCAGATGGTGTTACCTGGAGCTTAAAAAGCT
HKR179299 ARi48E03 pGCAP10 NM_178496.3  
GAGATGGTGTTACCTGGAGCTTAAAAAGCTGCACGCAAGTGTTAAACTTCTGACAATGGC
HKR394150 RBd85G06 pGCAP10 NM_178496.3  
GCTAGACGCCGTACGTGCCAGATGGTGTTACCTGGAGCTTAAAAAGCTGCACGCAAGTGT
HKR430110 RBdS075E14 pGCAP10 NM_178496.3  
GAGACGCCGTACGTGCCAGATGGTGTTACCTGGAGCTTAAAAAGCTGCACGCAAGTGTTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl