Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10097

HP ID(1) HP10097
Gene ID(2) 5716
Gene Symbol finder PSMD10
Protein Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 10
RefSeq NM_002814.2
Length of RefSeq (bp) 1546
Chromosome Xq22.3
Reference DDBJ accession
UniGene Hs.522752

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd35C11 pGCAP10 GGGCGACGTGAGGCGGGCGTTGCTCGCGCGACAAGTAGTTGCTGGGACAGCGAAATGGAG
RBdS014B18 pGCAP10 GGAGGCGGGCGTTGCTCGCGCGACAAGTAGTTGCTGGGACAGCGAAATGGAGGGGTGTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl