Prev. |  KEGG KO K06694 > 

RIKEN DNA Bank Human Resource - PSMD10

Gene ID NCBI Gene 5716 |  KEGG hsa:5716
Gene Symbol PSMD10
Protein Name proteasome 26S subunit, non-ATPase 10
Synonyms dJ889N15.2|p28|p28(GANK)
Ortholog resource in our bank

  PSMD10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008719 IRAK021N07 pCMV-SPORT6 BC011960 NM_170750 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374059 RBd35C11 pGCAP10 NM_002814.2  
GGGCGACGTGAGGCGGGCGTTGCTCGCGCGACAAGTAGTTGCTGGGACAGCGAAATGGAG
HKR405642 RBdS014B18 pGCAP10 NM_002814.2  
GGAGGCGGGCGTTGCTCGCGCGACAAGTAGTTGCTGGGACAGCGAAATGGAGGGGTGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl