Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10090

HP ID(1) HP10090
Gene ID(2) 51371
Gene Symbol finder POMP
Protein Name proteasome maturation protein
RefSeq NM_015932.3
Length of RefSeq (bp) 1347
Chromosome 13q12.3
Reference DDBJ accession
UniGene Hs.268742

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe61A08 pKA1U5 GGGAAGTGAGCGGCGGGGTCGACTGACGGTAACNGGGCAGAGAGGCTGTTCGCAGAGCTG
ARe83H09 pKA1U5 ATCCTGTGGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAG
ARe98E02 pKA1U5 GGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGAATG
ARf06G12 pKA1U5 GGGGGTCGACTGACGGTAACGGGGCAGAGAGGCNGTTTCGCAGAGCTGCGGAAGATGAAT
ARi39H10 pGCAP10 GGGCGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGA
RBdS070K15 pGCAP10 GGANNNNNNGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGAATGCCAGAG
RBdS081J02 pGCAP10 GGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGAATG
RBdS132H22 pGCAP10 GGGCGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl