Prev. |  KEGG KO K11599 > 

RIKEN DNA Bank Human Resource - POMP

Gene ID NCBI Gene 51371 |  KEGG hsa:51371
Gene Symbol POMP
Protein Name proteasome maturation protein
Synonyms C13orf12|HSPC014|PNAS-110|UMP1
Ortholog resources KEGG ortholog (KEGG orthology K11599) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001212 IRAK003A12 pCMV-SPORT6 BC003390 NM_015932 Full
HGY092703 IRAL031M15 pDNR-LIB BC014334 NM_015932 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064408 ARe61A08 pKA1U5 NM_015932.3  
GGGAAGTGAGCGGCGGGGTCGACTGACGGTAACNGGGCAGAGAGGCTGTTCGCAGAGCTG
HKR073377 ARe83H09 pKA1U5 NM_015932.3  
ATCCTGTGGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAG
HKR079298 ARe98E02 pKA1U5 NM_015932.3  
GGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGAATG
HKR082556 ARf06G12 pKA1U5 NM_015932.3  
GGGGGTCGACTGACGGTAACGGGGCAGAGAGGCNGTTTCGCAGAGCTGCGGAAGATGAAT
HKR175778 ARi39H10 pGCAP10 NM_015932.3  
GGGCGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGA
HKR428255 RBdS070K15 pGCAP10 NM_015932.3  
GGANNNNNNGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGAATGCCAGAG
HKR432618 RBdS081J02 pGCAP10 NM_015932.3  
GGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGAATG
HKR452990 RBdS132H22 pGCAP10 NM_015932.3  
GGGCGGGGTCGACTGACGGTAACGGGGCAGAGAGGCTGTTCGCAGAGCTGCGGAAGATGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl