Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10087

HP ID(1) HP10087
Gene ID(2) 10213
Gene Symbol finder PSMD14
Protein Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
RefSeq NM_005805.4
Length of RefSeq (bp) 1715
Chromosome 2q24.2
Reference DDBJ accession
UniGene Hs.567410

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi61E10 pGCAP10 GGATTCATCGCCGGTTTGCAGACAGAGCCGCGTCGGGTGTGCGCCGCTGCTGCTGTTGCC
RBb06E01 pKA1U5 GATCGCCGGTTTTGCAGACTGAGCCGCGTCGGGCTGTTGCGCCGCTGCTGCTGTTGCCTC
RBb27F05 pGCAP1 GGGCCCGGGCAACTCTTTTGAATGGAATCGGGCTGATTCATCGCCGGTTTGCAGACTGAG
RBd09H09 pGCAP10 GGTGCTTCGCGGCGGAGGCCCGGGCAACTCTTTTGAATGGAATCGGGCTGATTCATCGCC
RBd14E03 pGCAP10
RBd97C05 pGCAP10 GGCGGAGGCCCGGGCAACTCTTTTGAATGGAATCGGGCTGATTCATCGCCGGTTTGCAGA
RBdS177G09 pGCAP10 GCCGGGCAACTCTTTTGAATGGAATCGGGCTGATTCATCGCCGGTTTGCAGACTGAGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl