Prev. |  KEGG KO K03030 > 

RIKEN DNA Bank Human Resource - PSMD14

Gene ID NCBI Gene 10213 |  KEGG hsa:10213
Gene Symbol PSMD14
Protein Name proteasome 26S subunit, non-ATPase 14
Synonyms PAD1|POH1|RPN11
Ortholog resources KEGG ortholog (KEGG orthology K03030) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067279 IRAK168D07 pBluescriptR BC066336 NM_005805 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE017246 W01A043B22 pENTR-TOPO IRAK168D07 BC066336 NM_005805  
HGE017274 W01A043D02 pENTR-TOPO IRAK168D07 BC066336 NM_005805  
HGE017278 W01A043D06 pENTR-TOPO IRAK168D07 BC066336 NM_005805  
HGE017280 W01A043D08 pENTR-TOPO IRAK168D07 BC066336 NM_005805  
HGE017282 W01A043D10 pENTR-TOPO IRAK168D07 BC066336 NM_005805  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184506 ARi61E10 pGCAP10 NM_005805.4  
GGATTCATCGCCGGTTTGCAGACAGAGCCGCGTCGGGTGTGCGCCGCTGCTGCTGTTGCC
HKR322497 RBb06E01 pKA1U5 NM_005805.4  
GATCGCCGGTTTTGCAGACTGAGCCGCGTCGGGCTGTTGCGCCGCTGCTGCTGTTGCCTC
HKR330925 RBb27F05 pGCAP1 NM_005805.4  
GGGCCCGGGCAACTCTTTTGAATGGAATCGGGCTGATTCATCGCCGGTTTGCAGACTGAG
HKR363777 RBd09H09 pGCAP10 NM_005805.4  
GGTGCTTCGCGGCGGAGGCCCGGGCAACTCTTTTGAATGGAATCGGGCTGATTCATCGCC
HKR365699 RBd14E03 pGCAP10 NM_005805.4  
HKR398853 RBd97C05 pGCAP10 NM_005805.4  
GGCGGAGGCCCGGGCAACTCTTTTGAATGGAATCGGGCTGATTCATCGCCGGTTTGCAGA
HKR470953 RBdS177G09 pGCAP10 NM_005805.4  
GCCGGGCAACTCTTTTGAATGGAATCGGGCTGATTCATCGCCGGTTTGCAGACTGAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl