Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10062

HP ID(1) HP10062
Gene ID(2) 84833
Gene Symbol finder USMG5
Protein Name up-regulated during skeletal muscle growth 5 homolog (mouse)
RefSeq NM_032747.2
Length of RefSeq (bp) 580
Chromosome 10q24.33
Reference DDBJ accession
UniGene Hs.500921

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe71E12 pKA1U5 GGAGAGGTGGTTACATTCGTTGAAGGACACCAGCCTGCGGAATTTGCGGCTTTGGCAGAT
ARiS013E06 pGCAP10 GACATTCGTTGAAGGACNCCANCTGCGGAATTTGCGGCTTTGGCAGACCCAGCTGAGTCA
ARiS096C02 pGCAP10 GCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGC
RBb25C06 pGCAP1 GACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGATTGAAATCATGGC
RBb26B05 pGCAP1 GGTGGTTACATTCGTTGAAGGACACCAGCCTGCGGAATTTGCGGCTTTGGCAGATTGAAA
RBb35F10 pGCAP1 GTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGG
RBb46C10 pGCAP1 NCGGNCGAAGGACACCAGCNGCGGAANAAGCGGCTAAGGCAGATNGAAATCATGGCAGGT
RBd11H01 pGCAP10 GGCTTCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAAT
RBd18H06 pGCAP10 GACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGATTGAAATCATGGC
RBd48C03 pGCAP10 GGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGATTGA
RBd52A10 pGCAP10 CGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGC
RBd67A09 pGCAP10 GACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGATTGAAATCATGGC
RBd76G05 pGCAP10 GACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGCTGTTTGTTCCCAC
RBdS013B11 pGCAP10 GGTGGCTTCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGG
RBdS081O01 pGCAP10 GGGTGGCTTCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCG
RBdS105O17 pGCAP10 GTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGCG
RBdS156G10 pGCAP10 GAGGTGGCTTCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGC
RBdS187C09 pGCAP10 GNAGGTGGTTNCNTTCCTTGAAGGACGCCAGNTGCGGAATTNNNGNNTTTGGNNNATTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl