Prev. |  KEGG KO K18194 > 

RIKEN DNA Bank Human Resource - ATP5MD

Gene ID NCBI Gene 84833 |  KEGG hsa:84833
Gene Symbol ATP5MD
Protein Name ATP synthase membrane subunit DAPIT
Synonyms DAPIT|HCVFTP2|MC5DN6|USMG5|bA792D24.4
Ortholog resources KEGG ortholog (KEGG orthology K18194) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069785 IRAK174H17 pCMV-SPORT6 BC072683 NM_032747 Full
HGY088546 IRAL021G02 pDNR-LIB BC007087 NM_032747 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068508 ARe71E12 pKA1U5 NM_032747.2  
GGAGAGGTGGTTACATTCGTTGAAGGACACCAGCCTGCGGAATTTGCGGCTTTGGCAGAT
HKR205302 ARiS013E06 pGCAP10 NM_032747.2  
GACATTCGTTGAAGGACNCCANCTGCGGAATTTGCGGCTTTGGCAGACCCAGCTGAGTCA
HKR238450 ARiS096C02 pGCAP10 NM_032747.2  
GCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGC
HKR330054 RBb25C06 pGCAP1 NM_032747.2  
GACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGATTGAAATCATGGC
HKR330429 RBb26B05 pGCAP1 NM_032747.2  
GGTGGTTACATTCGTTGAAGGACACCAGCCTGCGGAATTTGCGGCTTTGGCAGATTGAAA
HKR334130 RBb35F10 pGCAP1 NM_032747.2  
GTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGG
HKR338458 RBb46C10 pGCAP1 NM_032747.2  
NCGGNCGAAGGACACCAGCNGCGGAANAAGCGGCTAAGGCAGATNGAAATCATGGCAGGT
HKR364569 RBd11H01 pGCAP10 NM_032747.2  
GGCTTCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAAT
HKR367374 RBd18H06 pGCAP10 NM_032747.2  
GACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGATTGAAATCATGGC
HKR379251 RBd48C03 pGCAP10 NM_032747.2  
GGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGATTGA
HKR380810 RBd52A10 pGCAP10 NM_032747.2  
CGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGC
HKR386809 RBd67A09 pGCAP10 NM_032747.2  
GACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGATTGAAATCATGGC
HKR390549 RBd76G05 pGCAP10 NM_032747.2  
GACATTCGTTGAAGGACACCAGCTGCGGAATTTGCGGCTTTGGCAGCTGTTTGTTCCCAC
HKR405235 RBdS013B11 pGCAP10 NM_032747.2  
GGTGGCTTCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGG
HKR432737 RBdS081O01 pGCAP10 NM_032747.2  
GGGTGGCTTCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCG
HKR442353 RBdS105O17 pGCAP10 NM_032747.2  
GTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGCGGAATTTGCG
HKR462554 RBdS156G10 pGCAP10 NM_032747.2  
GAGGTGGCTTCTTCCGGCCGGGCCGAGAGGTGGTTACATTCGTTGAAGGACACCAGCTGC
HKR474857 RBdS187C09 pGCAP10 NM_032747.2  
GNAGGTGGTTNCNTTCCTTGAAGGACGCCAGNTGCGGAATTNNNGNNTTTGGNNNATTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl