Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10029

HP ID(1) HP10029
Gene ID(2) 56005
Gene Symbol finder C19orf10
Protein Name chromosome 19 open reading frame 10
RefSeq NM_019107.3
Length of RefSeq (bp) 1067
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.465645

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe70H06 pKA1U5 GAGTCCAACATGGCCGGCGCCCAGCGGAGGGTGGAACNGCGTCGGCGCGAGCTTGTGGGC
ARe99B01 pKA1U5 GAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCGTCGGCGCGAGCTTGTGGGCC
ARi19B02 pGCAP10 GAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCGTCGGCGCGAGCTTGTGGGCC
ARi68A02 pGCAP10 GAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCGTCGGCGCGAGCTTGTGGGCC
ARiS122B08 pGCAP10 GAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCGTCGGCGCGAGCTTGTGGGCC
RBb07G08 pKA1U5 GGCGGACCGCGGAGGACAAATATACGTGTATGTTCACTTACGCCTCTCAAGGAGGGACCA
RBd20C10 pGCAP10 GGCCCCTGCCCTGAGGACCCTAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl