Prev. | 

RIKEN DNA Bank Human Resource - MYDGF

Gene ID NCBI Gene 56005 |  KEGG hsa:56005
Gene Symbol MYDGF
Protein Name myeloid derived growth factor
Synonyms C19orf10|EUROIMAGE1875335|IL25|IL27|IL27w|R33729_1|SF20
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084497 IRAL011E01 pOTB7 BC003639 NM_019107 Partial
HGY091052 IRAL027K12 pOTB7 BC010129 NM_019107 Full
HGY091732 IRAL029F12 pOTB7 BC014655 NM_019107 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068174 ARe70H06 pKA1U5 NM_019107.3  
GAGTCCAACATGGCCGGCGCCCAGCGGAGGGTGGAACNGCGTCGGCGCGAGCTTGTGGGC
HKR079625 ARe99B01 pKA1U5 NM_019107.3  
GAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCGTCGGCGCGAGCTTGTGGGCC
HKR167626 ARi19B02 pGCAP10 NM_019107.3  
GAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCGTCGGCGCGAGCTTGTGGGCC
HKR187202 ARi68A02 pGCAP10 NM_019107.3  
GAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCGTCGGCGCGAGCTTGTGGGCC
HKR248832 ARiS122B08 pGCAP10 NM_019107.3  
GAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCGTCGGCGCGAGCTTGTGGGCC
HKR322952 RBb07G08 pKA1U5 NM_019107.3  
GGCGGACCGCGGAGGACAAATATACGTGTATGTTCACTTACGCCTCTCAAGGAGGGACCA
HKR368058 RBd20C10 pGCAP10 NM_019107.3  
GGCCCCTGCCCTGAGGACCCTAGTCCAACATGGCGGCGCCCAGCGGAGGGTGGAACGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl