Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10021

HP ID(1) HP10021
Gene ID(2) 55505
Gene Symbol finder NOP10
Protein Name NOP10 ribonucleoprotein homolog (yeast)
RefSeq NM_018648.3
Length of RefSeq (bp) 552
Chromosome 15q14-q15
Reference DDBJ accession
UniGene Hs.14317

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi11G04 pGCAP10 GAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCTCCAGT
ARi16H10 pGCAP10 GGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATG
ARiS049P11 pGCAP10 GACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCT
ARiS085J10 pGCAP10 GACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCT
RBd08G03 pGCAP10 GGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCTCCA
RBd35G08 pGCAP10 GACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCT
RBd45F09 pGCAP10 GAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCTCCAGT
RBd87A01 pGCAP10 GGCGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCA
RBdS007D10 pGCAP10 GGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATG
RBdS083O07 pGCAP10 GGCGGTCGGGCGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATA
RBdS104A15 pGCAP10 GGGGCGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGAT
RBdS156N02 pGCAP10 GACCTCAACGAGCAGGGAGATCGAGTCTATACGCTGAAGAAATTTGACCCGATGGGACAA
RBdS187C11 pGCAP10 GGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl