Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NOP10

Gene ID (NCBI) 55505
Gene Symbol NOP10
Protein Name NOP10 ribonucleoprotein
Synonyms DKCB1|NOLA3|NOP10P
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11130)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX056053 IRAK140C05 pCMV-SPORT6 BC063023 NM_018648 Full
HGY091145 IRAL027O09 pOTB7 BC008886 NM_018648 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003669 W01A009C21 pENTR-TOPO IRAK140C05 BC063023 NM_018648  
HGE003697 W01A009E01 pENTR-TOPO IRAL027O09 BC008886 NM_018648  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164548 ARi11G04 pGCAP10 NM_018648.3  
GAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCTCCAGT
HKR166578 ARi16H10 pGCAP10 NM_018648.3  
GGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATG
HKR219971 ARiS049P11 pGCAP10 NM_018648.3  
GACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCT
HKR234226 ARiS085J10 pGCAP10 NM_018648.3  
GACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCT
HKR363347 RBd08G03 pGCAP10 NM_018648.3  
GGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCTCCA
HKR374152 RBd35G08 pGCAP10 NM_018648.3  
GACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCT
HKR378129 RBd45F09 pGCAP10 NM_018648.3  
GAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCTCCAGT
HKR394801 RBd87A01 pGCAP10 NM_018648.3  
GGCGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCA
HKR402882 RBdS007D10 pGCAP10 NM_018648.3  
GGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATG
HKR433543 RBdS083O07 pGCAP10 NM_018648.3  
GGCGGTCGGGCGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATA
HKR441615 RBdS104A15 pGCAP10 NM_018648.3  
GGGGCGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGAT
HKR462714 RBdS156N02 pGCAP10 NM_018648.3  
GACCTCAACGAGCAGGGAGATCGAGTCTATACGCTGAAGAAATTTGACCCGATGGGACAA
HKR474859 RBdS187C11 pGCAP10 NM_018648.3  
GGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl