Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09295

HP ID(1) HP09295
Gene ID(2) 80336
Gene Symbol finder PABPC1L
Protein Name poly(A) binding protein, cytoplasmic 1-like
RefSeq NM_001124756.1
Length of RefSeq (bp) 2129
Chromosome 20q12-q13.1
Reference DDBJ accession
UniGene Hs.641481

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS187N05 pGCAP10 CGGCCGGCCGATGGCCCGGGTGAGCGCGGGGCCGCTGGGTGACCCGGCTCCTGCTTGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl