Prev. |  KEGG KO K13126 > 

RIKEN DNA Bank Human Resource - PABPC1L

Gene ID NCBI Gene 80336 |  KEGG hsa:80336
Gene Symbol PABPC1L
Protein Name poly(A) binding protein cytoplasmic 1 like
Synonyms C20orf119|EPAB|PABPC1L1|dJ1069P2.3
Ortholog resources KEGG ortholog (KEGG orthology K13126) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR475117 RBdS187N05 pGCAP10 NM_001124756.1  
CGGCCGGCCGATGGCCCGGGTGAGCGCGGGGCCGCTGGGTGACCCGGCTCCTGCTTGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl