Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09258

HP ID(1) HP09258
Gene ID(2) 84305
Gene Symbol finder WIBG
Protein Name within bgcn homolog (Drosophila)
RefSeq NM_032345.2
Length of RefSeq (bp) 1244
Chromosome 12q13.2
Reference DDBJ accession
UniGene Hs.505687

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS177D06 pGCAP10 AAGATGGCGACTCCCTATGTTACTGACGAGACCGGCGGCAAGTATATCGCGTCAACACAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl