Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177D06

Clone ID RBdS177D06
HP ID HP09258
Gene ID 84305
Gene Symbol WIBG
Protein Name within bgcn homolog (Drosophila)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032345.2
Length of RefSeq (bp) 1244
Chromosome 12q13.2
Reference DDBJ accession
UniGene Hs.505687
5'-terminal sequence AAGATGGCGACTCCCTATGTTACTGACGAGACCGGCGGCAAGTATATCGCGTCAACACAG
2011.08.28