Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09251

HP ID(1) HP09251
Gene ID(2) 5613
Gene Symbol finder PRKX
Protein Name protein kinase, X-linked
RefSeq NM_005044.3
Length of RefSeq (bp) 6054
Chromosome Xp22.3
Reference DDBJ accession
UniGene Hs.390788

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS156P21 pGCAP10 GCTGGCCCGGTGCCCCGGACCTGAGTGCGTCCCCATGGAGGCGCCCGGGCTGGCCCAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl