Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156P21

Clone ID RBdS156P21
HP ID HP09251
Gene ID 5613
Gene Symbol PRKX
Protein Name protein kinase, X-linked
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005044.3
Length of RefSeq (bp) 6054
Chromosome Xp22.3
Reference DDBJ accession
UniGene Hs.390788
5'-terminal sequence GCTGGCCCGGTGCCCCGGACCTGAGTGCGTCCCCATGGAGGCGCCCGGGCTGGCCCAGGC
2011.08.28