Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09236

HP ID(1) HP09236
Gene ID(2) 345895
Gene Symbol finder RSPH4A
Protein Name radial spoke head 4 homolog A (Chlamydomonas)
RefSeq NM_001010892.1
Length of RefSeq (bp) 2825
Chromosome 6q22.1
Reference DDBJ accession
UniGene Hs.160380

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS156G15 pGCAP10 GGTCTCCGCCCTCGAATCCTGGCAACAGGCGCGGTGAGTTTTTCTGAGAGGAACCCGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl