Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09185

HP ID(1) HP09185
Gene ID(2) 84950
Gene Symbol finder PRPF38A
Protein Name PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
RefSeq NM_032864.3
Length of RefSeq (bp) 2780
Chromosome 1p33-p32.1
Reference DDBJ accession
UniGene Hs.5301

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS132F20 pGCAP10 GACACTACGGTGTTTCCGGCTTCAAGATGGTCGCCTAAGCTGTTTAGTGAAACTTCTTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl