Prev. |  KEGG KO K12849 > 

RIKEN DNA Bank Human Resource - PRPF38A

Gene ID NCBI Gene 84950 |  KEGG hsa:84950
Gene Symbol PRPF38A
Protein Name pre-mRNA processing factor 38A
Synonyms PRP38A|Prp38
Ortholog resources KEGG ortholog (KEGG orthology K12849) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR452940 RBdS132F20 pGCAP10 NM_032864.3  
GACACTACGGTGTTTCCGGCTTCAAGATGGTCGCCTAAGCTGTTTAGTGAAACTTCTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl