Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09182

HP ID(1) HP09182
Gene ID(2) 83855
Gene Symbol finder KLF16
Protein Name Kruppel-like factor 16
RefSeq NM_031918.2
Length of RefSeq (bp) 2888
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.136280

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS132E02 pGCAP10 GACTCNAGCAGCCGCCGCCGGCCGGACGGACGCCGCTCCCGCCGCCTCCGCTCCGCCCGC
RBdS187I10 pGCAP10 GACTCCTCAGGACGAGGTGTGCAGAGGAGTGTCTGAGTGCCTGCCAGGTTTCTGATCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl