Prev. |  KEGG KO K09208 > 

RIKEN DNA Bank Human Resource - KLF16

Gene ID NCBI Gene 83855 |  KEGG hsa:83855
Gene Symbol KLF16
Protein Name Kruppel like factor 16
Synonyms BTEB4|DRRF|NSLP2
Ortholog resources KEGG ortholog (KEGG orthology K09208) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR452898 RBdS132E02 pGCAP10 NM_031918.2  
GACTCNAGCAGCCGCCGCCGGCCGGACGGACGCCGCTCCCGCCGCCTCCGCTCCGCCCGC
HKR475002 RBdS187I10 pGCAP10 NM_031918.2  
GACTCCTCAGGACGAGGTGTGCAGAGGAGTGTCTGAGTGCCTGCCAGGTTTCTGATCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl