Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09181

HP ID(1) HP09181
Gene ID(2) 83480
Gene Symbol finder PUS3
Protein Name pseudouridylate synthase 3
RefSeq NM_031307.3
Length of RefSeq (bp) 1862
Chromosome 11q24.2
Reference DDBJ accession
UniGene Hs.660922

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS132C23 pGCAP10 GTCCTTTCTCGGAAACGCGGCGCGGCCGGCTGCCGGAAAACAGGGCAGACCTGTATGATT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl