Prev. |  KEGG KO K01855 > 

RIKEN DNA Bank Human Resource - PUS3

Gene ID NCBI Gene 83480 |  KEGG hsa:83480
Gene Symbol PUS3
Protein Name pseudouridine synthase 3
Synonyms 2610020J05Rik|FKSG32|MRT55
Ortholog resources KEGG ortholog (KEGG orthology K01855) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001342 IRAK003F22 pCMV-SPORT6 BC004822 NM_031307
HGX005813 IRAK014I21 pCMV-SPORT6 BC013427 NM_031307 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR452871 RBdS132C23 pGCAP10 NM_031307.3  
GTCCTTTCTCGGAAACGCGGCGCGGCCGGCTGCCGGAAAACAGGGCAGACCTGTATGATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl