Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09179

HP ID(1) HP09179
Gene ID(2) 3780
Gene Symbol finder KCNN1
Protein Name potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
RefSeq NM_002248.3
Length of RefSeq (bp) 2657
Chromosome 19p13.1
Reference DDBJ accession
UniGene Hs.158173

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS132A13 pGCAP10 GACTTGTCTTCGCGCTCGGGCAGGGCGCAGGGACTCCGGCTGCGGCGGCCGACTCCGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl