Prev. |  KEGG KO K04942 > 

RIKEN DNA Bank Human Resource - KCNN1

Gene ID NCBI Gene 3780 |  KEGG hsa:3780
Gene Symbol KCNN1
Protein Name potassium calcium-activated channel subfamily N member 1
Synonyms KCa2.1|SK1|SKCA1|hSK1
Ortholog resource in our bank

  KCNN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR452813 RBdS132A13 pGCAP10 NM_002248.3 done
GACTTGTCTTCGCGCTCGGGCAGGGCGCAGGGACTCCGGCTGCGGCGGCCGACTCCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl