Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09168

HP ID(1) HP09168
Gene ID(2) 54991
Gene Symbol finder C1orf159
Protein Name chromosome 1 open reading frame 159
RefSeq NM_017891.4
Length of RefSeq (bp) 2122
Chromosome 1p36.33
Reference DDBJ accession
UniGene Hs.235095

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS110I16 pGCAP10 GGAGGGCGGGGTGTACGAAAGAGAAACCCGGAGGGCGCCGGGGACTGGGCCGGGGTCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl