Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110I16

Clone ID RBdS110I16
HP ID HP09168
Gene ID 54991
Gene Symbol C1orf159
Protein Name chromosome 1 open reading frame 159
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_017891.4
Length of RefSeq (bp) 2122
Chromosome 1p36.33
Reference DDBJ accession
UniGene Hs.235095
5'-terminal sequence GGAGGGCGGGGTGTACGAAAGAGAAACCCGGAGGGCGCCGGGGACTGGGCCGGGGTCTGC
2011.08.28