Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09162

HP ID(1) HP09162
Gene ID(2) 55255
Gene Symbol finder WDR41
Protein Name WD repeat domain 41
RefSeq NM_018268.2
Length of RefSeq (bp) 2608
Chromosome 5q14.1
Reference DDBJ accession
UniGene Hs.482573

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS110F21 pGCAP10 GACTCGGAGCAGCGCGCGCCCCGCAATCGCCGCAGCCGCCCCCGCCGTCGGCCGCCGCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl